BP235998

From Wikicell

Jump to: navigation, search

Image:Normal Image.jpg


IDENTIFIERS

dbEST Id:       25470818
EST name:       BP235998
GenBank Acc:    BP235998
GenBank gi:     52108908

CLONE INFO
Clone Id:       HCR06628 (5')
DNA type:       cDNA

PRIMERS
PolyA Tail:     Unknown

SEQUENCE
                GAGTCCGTCACTGGAAGCCGAGAGGAGAGGACAGCTGGTTGTGGGAGAGTTCCCCCGCCT
                CAGACTCCTGGTTTTTTCCAGGAGACACACTGAGCTGAGACTCACTTTTCTCTTCCTGAA
                TTTGAACCACCGTTTCCATCGTCTCGTAGTCCGACGCCTGGGGCGATGGATCCGTTTACG
                GAGAAACTGCTGGAGCGAACCCGTGCCAGGCGAGAGAATCTTCAGAGAAAAATGGCTGAG
                AGGCCCACAGCAGCTCCAAGGTCTATGACTCATGCTAAGCGAGCTAGACAGCCACTTTCA
                GAAGCAAGTAACCAGCAGCCCCCTCTCTGGTGGTGAAGAGAAATCTTGTACAAAACCATC
                GCCATCAAAAAAACGCTGTTCTGACAACACTGAAGTAGAAGTTTCTAACTTGGGAAATAA
                ACAACCAGTTGAGTCGACATCTGCAAAATCTTGTTCTCCAAGTCCTGTGTCTCCTCAGGT
                GCAGCCACAAGCAGCAGATACCATCAGTGATTCTGTTGCTGTCCCGGCATCACTGCTGGG
                CATGAGGAGAGGGCTGAACTCNAGATTGGGAGCAACTGCAGCC

Entry Created:  Sep 15 2004
Last Updated:   Apr 11 2006

LIBRARY
dbEST lib id:   16381
Lib Name:       Sugano cDNA library, coronary artery endothelial cell
Organism:       Homo sapiens
Tissue type:    coronary artery
Cell type:      endothelial cell

SUBMITTER
Name:           Yutaka Suzuki
Lab:            Department of Virology
Institution:    Institute of Medical Science, University of Tokyo
Address:        4-6-1, Shirokanedai, Minatoku, Tokyo 108-8639, Japan

CITATIONS
PubMed ID:      15342556
Title:          Sequence comparison of human and mouse genes reveals a
                homologous block structure in the promoter regions
Authors:        Suzuki,Y., Yamashita,R., Shirota,M., Sakakibara,Y.,
                Chiba,J., Mizushima-Sugano,J., Nakai,K., Sugano,S.
Citation:       Genome Res. 14 (9): 1711-1718 2004


MAP DATA




Sequence Feature

qName matches misMatches repMatches nCount qNumInsert qBaseInsert tNumInsert tBaseInsert strand qSize qStart qEnd tName tSize tStart tEnd
BP235998 579 2 0 1 1 1 2 8880 + 583 0 583 chr7 158821424 36395995 36405457



Block Feature

qName blockCount blockSizes qStarts tStarts
BP235998 4 183,139,15,245, 0,183,323,338, 36395995,36402399,36402538,36405212,





Path:Human-->Circulatory System-->Cardiovascular System-->Blood Vessel-->Artery-->Vascular Wall-->BP235998

Personal tools